expression plasmid ppicza (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
90
Structured Review
Thermo Fisher
expression plasmid ppicza
Expression Plasmid Ppicza, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ppicza+expression+plasmid/pmc08877874-34-9-15
Average 90 stars, based on 1 article reviews
Expression Plasmid Ppicza, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ppicza+expression+plasmid/pmc08877874-34-9-15
Average 90 stars, based on 1 article reviews
expression plasmid ppicza - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Polymerase Chain Reaction:Article Title: Copsin, a Novel Peptide-based Fungal Antibiotic Interfering with the Peptidoglycan Synthesis Article Snippet: The coding sequences of the copsin precursor protein were amplified from cDNA by PCR with the Phusion high fidelity DNA polymerase (Thermo Scientific) according to standard protocols ( 49 ): forward primer, 5′-CCG GAATTC ATGAAACTTTCTACTTCTTTGCTCG-3′, and reverse primer, 5′-ACGC GTCGAC TTAACAACGAGGGCAGGGG-3′. .. The PCR product was cloned into the Article Title: Copsin, a Novel Peptide-based Fungal Antibiotic Interfering with the Peptidoglycan Synthesis Article Snippet: The coding sequence of the copsin precursor protein was amplified from cDNA by PCR with the Phusion high-fidelity DNA polymerase (Thermo Scientific) according to standard protocols (Sambrook J, Russell D, 2001, Molecular cloning, 3rd edition). .. FP:5’CCGGAATTCATGAAACTTTCTACTTCTTTGCT CG-3’; RP:5’ACGCGTCGACTTAACAACGAGGGCAGGGG3’; The PCR product was cloned into the Clone Assay:Article Title: Copsin, a Novel Peptide-based Fungal Antibiotic Interfering with the Peptidoglycan Synthesis Article Snippet: The coding sequences of the copsin precursor protein were amplified from cDNA by PCR with the Phusion high fidelity DNA polymerase (Thermo Scientific) according to standard protocols ( 49 ): forward primer, 5′-CCG GAATTC ATGAAACTTTCTACTTCTTTGCTCG-3′, and reverse primer, 5′-ACGC GTCGAC TTAACAACGAGGGCAGGGG-3′. .. The PCR product was cloned into the Article Title: Induction of antibacterial proteins and peptides in the coprophilous mushroom Coprinopsis cinerea in response to bacteria Article Snippet: .. The codon-optimized prepro-Copsin (CPP1) insert and the native prepro-CPP2 insert were cloned into the Article Title: Copsin, a Novel Peptide-based Fungal Antibiotic Interfering with the Peptidoglycan Synthesis Article Snippet: The coding sequence of the copsin precursor protein was amplified from cDNA by PCR with the Phusion high-fidelity DNA polymerase (Thermo Scientific) according to standard protocols (Sambrook J, Russell D, 2001, Molecular cloning, 3rd edition). .. FP:5’CCGGAATTCATGAAACTTTCTACTTCTTTGCT CG-3’; RP:5’ACGCGTCGACTTAACAACGAGGGCAGGGG3’; The PCR product was cloned into the Expressing:Article Title: Copsin, a Novel Peptide-based Fungal Antibiotic Interfering with the Peptidoglycan Synthesis Article Snippet: The coding sequences of the copsin precursor protein were amplified from cDNA by PCR with the Phusion high fidelity DNA polymerase (Thermo Scientific) according to standard protocols ( 49 ): forward primer, 5′-CCG GAATTC ATGAAACTTTCTACTTCTTTGCTCG-3′, and reverse primer, 5′-ACGC GTCGAC TTAACAACGAGGGCAGGGG-3′. .. The PCR product was cloned into the Article Title: Induction of antibacterial proteins and peptides in the coprophilous mushroom Coprinopsis cinerea in response to bacteria Article Snippet: .. The codon-optimized prepro-Copsin (CPP1) insert and the native prepro-CPP2 insert were cloned into the Article Title: Copsin, a Novel Peptide-based Fungal Antibiotic Interfering with the Peptidoglycan Synthesis Article Snippet: The coding sequence of the copsin precursor protein was amplified from cDNA by PCR with the Phusion high-fidelity DNA polymerase (Thermo Scientific) according to standard protocols (Sambrook J, Russell D, 2001, Molecular cloning, 3rd edition). .. FP:5’CCGGAATTCATGAAACTTTCTACTTCTTTGCT CG-3’; RP:5’ACGCGTCGACTTAACAACGAGGGCAGGGG3’; The PCR product was cloned into the Plasmid Preparation:Article Title: Copsin, a Novel Peptide-based Fungal Antibiotic Interfering with the Peptidoglycan Synthesis Article Snippet: The coding sequences of the copsin precursor protein were amplified from cDNA by PCR with the Phusion high fidelity DNA polymerase (Thermo Scientific) according to standard protocols ( 49 ): forward primer, 5′-CCG GAATTC ATGAAACTTTCTACTTCTTTGCTCG-3′, and reverse primer, 5′-ACGC GTCGAC TTAACAACGAGGGCAGGGG-3′. .. The PCR product was cloned into the Article Title: Induction of antibacterial proteins and peptides in the coprophilous mushroom Coprinopsis cinerea in response to bacteria Article Snippet: .. The codon-optimized prepro-Copsin (CPP1) insert and the native prepro-CPP2 insert were cloned into the Article Title: Copsin, a Novel Peptide-based Fungal Antibiotic Interfering with the Peptidoglycan Synthesis Article Snippet: The coding sequence of the copsin precursor protein was amplified from cDNA by PCR with the Phusion high-fidelity DNA polymerase (Thermo Scientific) according to standard protocols (Sambrook J, Russell D, 2001, Molecular cloning, 3rd edition). .. FP:5’CCGGAATTCATGAAACTTTCTACTTCTTTGCT CG-3’; RP:5’ACGCGTCGACTTAACAACGAGGGCAGGGG3’; The PCR product was cloned into the Cloning:Article Title: Induction of antibacterial proteins and peptides in the coprophilous mushroom Coprinopsis cinerea in response to bacteria. Article Snippet: .. Cloning, production and purification of Copsin and CPP2 The codon-optimized prepro-Copsin (CPP1) insert and the native prepro-CPP2 insert were cloned into the Purification:Article Title: Induction of antibacterial proteins and peptides in the coprophilous mushroom Coprinopsis cinerea in response to bacteria. Article Snippet: .. Cloning, production and purification of Copsin and CPP2 The codon-optimized prepro-Copsin (CPP1) insert and the native prepro-CPP2 insert were cloned into the |